View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2498_low_77 (Length: 206)

Name: NF2498_low_77
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2498_low_77
NF2498_low_77
[»] chr4 (1 HSPs)
chr4 (129-189)||(17451668-17451728)
[»] chr5 (1 HSPs)
chr5 (125-163)||(42758892-42758930)


Alignment Details
Target: chr4 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 129 - 189
Target Start/End: Original strand, 17451668 - 17451728
Alignment:
129 cgattgattatccttaatctaatcgcttggtggatcttttgtttcccttagccagcattca 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
17451668 cgattgattatccttaatctaatcgcttggtggatcttttgtttcccttcgccagcattca 17451728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 125 - 163
Target Start/End: Original strand, 42758892 - 42758930
Alignment:
125 ttgtcgattgattatccttaatctaatcgcttggtggat 163  Q
    |||||||||||||| ||||||||||||||||||||||||    
42758892 ttgtcgattgattacccttaatctaatcgcttggtggat 42758930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University