View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2498_low_78 (Length: 204)

Name: NF2498_low_78
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2498_low_78
NF2498_low_78
[»] chr3 (1 HSPs)
chr3 (18-189)||(50102050-50102221)


Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 50102050 - 50102221
Alignment:
18 gtaacaattaaatacattgtcgattcagatttcgatgagcttgatatgattaaagactatcaaaaatatatgttttatgattgctctgtctgtagtaaat 117  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
50102050 gtaacaattaaatacattgtcgattcagatttagatgagcttgatatgattaaagaccatcaaaaatatatgttttatgattgctctgtctgtagtaaat 50102149  T
118 ggcctgggaaaaagcactggagggtaaccattactatgttgatctaattgtttcttgggttatgtttttcat 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50102150 ggcctgggaaaaagcactggagggtaaccattactatgttgatctaattgtttcttgggttatgtttttcat 50102221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University