View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2498_low_79 (Length: 203)
Name: NF2498_low_79
Description: NF2498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2498_low_79 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 4 - 169
Target Start/End: Original strand, 43013682 - 43013846
Alignment:
| Q |
4 |
aacaagtaacttatctat--tttgattgataaatacttaaaccaaaaagttgtgacctggtagtagaactataattagatctacccaataaatagcaacg |
101 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
43013682 |
aacaagtaacttatctatattttgattgataaatacttaaaccaaaaagttgtgacctggtag---aactataattagatgtacccaataaatagcaacg |
43013778 |
T |
|
| Q |
102 |
ctaaattgaccaggcaactatgtcactaaagaaacgtgttaactgttaaactaaagtataggaagtaa |
169 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43013779 |
ctaaattgaccaggcaactaagtcactaaagaaacgtgttaactgttaaactaaagtataggaagtaa |
43013846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University