View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2499_high_34 (Length: 234)

Name: NF2499_high_34
Description: NF2499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2499_high_34
NF2499_high_34
[»] chr5 (1 HSPs)
chr5 (19-227)||(36186091-36186299)
[»] chr6 (1 HSPs)
chr6 (120-221)||(21377090-21377191)


Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 36186299 - 36186091
Alignment:
19 aacatttccattaattttttaacatgtgttattgggtcacttcttaaacaaacaaaacttgagcaaaattaaacttgagccaaagctccttctcctactt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||    
36186299 aacatttccattaattttttaacatgtgttattgggtcacttcttaaacaaataaaacttgagcaaaattaaacttgagccaaagctccttctactactt 36186200  T
119 gttctcgttgcagtcttaaaaacgaaatttttcttcaatgtgtacgagattgcagcttttgccttaggatatggcatcaattaggcttcattaattatga 218  Q
    ||||||||||||||||| ||||||||||||||||||| ||| | ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||    
36186199 gttctcgttgcagtcttcaaaacgaaatttttcttcactgtatccgagactgcagcttttgccttaggatatggcatcaattaggcttcactaattatga 36186100  T
219 gttcatctc 227  Q
    |||| ||||    
36186099 gttcttctc 36186091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 120 - 221
Target Start/End: Original strand, 21377090 - 21377191
Alignment:
120 ttctcgttgcagtcttaaaaacgaaatttttcttcaatgtgtacgagattgcagcttttgccttaggatatggcatcaattaggcttcattaattatgag 219  Q
    |||||||||||||||| | || || |  |||||||| |||||  |||| |||| ||||| ||||||||||||||||||||| ||||||| ||||| ||||    
21377090 ttctcgttgcagtcttcagaatgagacctttcttcattgtgtttgagactgcaacttttcccttaggatatggcatcaatttggcttcactaattctgag 21377189  T
220 tt 221  Q
    ||    
21377190 tt 21377191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University