View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2499_high_6 (Length: 487)
Name: NF2499_high_6
Description: NF2499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2499_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 4e-76; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 220 - 388
Target Start/End: Complemental strand, 49752264 - 49752096
Alignment:
| Q |
220 |
aggaaattaaaataatagaaatcttgtttcttcccttcagaaaatgaaattttgttttttgacagtgatatgtaacaattttatcactatttcgttatct |
319 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49752264 |
aggaaattcaaataatagaaatcttgtttcttcccttcaaaaaaagaaattttgttttttgatagtgatatgtaacaattttatcactatttcgttatct |
49752165 |
T |
 |
| Q |
320 |
tctgtcattgtctttcccttattggtattttggccgacggtgtgcattgtatcttgtgcttgcatatag |
388 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49752164 |
tatgtcattgtctttcccttattggtattttggccgacggtgtgcattgtatcttgtgcttggatatag |
49752096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 72 - 228
Target Start/End: Complemental strand, 49753163 - 49753012
Alignment:
| Q |
72 |
tgaagttcggttatgaatgattagttgtgtggctgccttggagcaatgcatatgattttannnnnnnnngtttgtaggtagataattgattttttattat |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||| ||||||||||||||| |
|
|
| T |
49753163 |
tgaagttcggttatgaatgattagttgtgtggctgccttggagcaatgcatatgatttt---ttgttttgttttt--gtagatatttgattttttattat |
49753069 |
T |
 |
| Q |
172 |
gctctagattcgattggaattttagatcgggaagtgtttacataagcaaggaaatta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49753068 |
gctctagattcgattggaattttagatcggaaagtgtttacataagcaaggaaatta |
49753012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 432 - 487
Target Start/End: Complemental strand, 49752052 - 49751997
Alignment:
| Q |
432 |
gaaaacgtaagaatagactaattgattaaaatgtttttacactttataaacttcct |
487 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49752052 |
gaaaacgtaagaatagactaattgattaaaatgtttttacactttataaacttcct |
49751997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University