View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2499_low_23 (Length: 274)
Name: NF2499_low_23
Description: NF2499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2499_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 258
Target Start/End: Complemental strand, 28941526 - 28941279
Alignment:
| Q |
11 |
agaatatgcaagtgtgtttttgtttctctattgtgatgtcactaaacgattgttgaagctgacacaataaattatttctttgcaacaaattatgtgactt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28941526 |
agaatatgcaagtgtgtttttgtttctctattgtgatgtcactaagcgattgttgaagctgacacaataaattatttctttgcacaaaattatgtgactt |
28941427 |
T |
|
| Q |
111 |
ctgattctctcttaacaatctctaaatgagcgatgaagtttaaataagaaccacacaaagtatgtaagtgtatcttttatttttctttaggaaagttgag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28941426 |
ctgattctctcttaacaatctctaaatgagcggtgaagtttaaataagaaccacacaaagtatataagtgtatcttttatttttctttaggaaagttgag |
28941327 |
T |
|
| Q |
211 |
ggaaacataaaaagttattgcgtctcgcaaaatatgaaagcgtgtatt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28941326 |
ggaaacataaaaagttattgcgtctcgcaaaatatgaaagcgtgtatt |
28941279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University