View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2499_low_27 (Length: 253)
Name: NF2499_low_27
Description: NF2499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2499_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 28 - 233
Target Start/End: Complemental strand, 31497564 - 31497359
Alignment:
| Q |
28 |
caagaaagttatctagccccctgcagtttagggctggttcaaagtaaacataaatggagaagctgtgaagaatctagacaaagcagctgttgggggtatt |
127 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31497564 |
caaggaagttatctagccccctgcaatttagggctagttcaaagtaaacataaatggagaagctgtgaagaatctagacaaagcagctgttgggggtatt |
31497465 |
T |
 |
| Q |
128 |
tttaaagatgctactgataacaatagagttagcaacttcaaaatgatacactaatctatttataaatttttgaaaaagtccccgagctagtcccctttta |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31497464 |
tttaaagatgctactgataacaatagagttagcaacttcaaaatgatacactaatctatttataactttttgaaaaagtccccgagctagtcccctttta |
31497365 |
T |
 |
| Q |
228 |
tatttt |
233 |
Q |
| |
|
|||||| |
|
|
| T |
31497364 |
tatttt |
31497359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University