View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2499_low_32 (Length: 237)
Name: NF2499_low_32
Description: NF2499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2499_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 15233476 - 15233366
Alignment:
| Q |
1 |
attgaccaaccattatgatttcaatgaatcaaggtttatgtatgtctttagtttctacaaaatcatatacttttaaatttaatccctaaaaaatgtattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15233476 |
attgaccaaccattatgatttcaatgaatcaaggtttatgtatgtctttagtttctacaaaatcatatacttttaaatttaatccctaaaaaa-gtattc |
15233378 |
T |
|
| Q |
101 |
atttggagtccc |
112 |
Q |
| |
|
||||| |||||| |
|
|
| T |
15233377 |
atttgtagtccc |
15233366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 224
Target Start/End: Complemental strand, 15233290 - 15233253
Alignment:
| Q |
188 |
gtctaataaaacctagacttg-aaagatcgtgggaggt |
224 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15233290 |
gtctaataaaacctagacttgaaaagatcgtgggaggt |
15233253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University