View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2499_low_36 (Length: 234)
Name: NF2499_low_36
Description: NF2499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2499_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 36186299 - 36186091
Alignment:
| Q |
19 |
aacatttccattaattttttaacatgtgttattgggtcacttcttaaacaaacaaaacttgagcaaaattaaacttgagccaaagctccttctcctactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36186299 |
aacatttccattaattttttaacatgtgttattgggtcacttcttaaacaaataaaacttgagcaaaattaaacttgagccaaagctccttctactactt |
36186200 |
T |
|
| Q |
119 |
gttctcgttgcagtcttaaaaacgaaatttttcttcaatgtgtacgagattgcagcttttgccttaggatatggcatcaattaggcttcattaattatga |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||| | ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36186199 |
gttctcgttgcagtcttcaaaacgaaatttttcttcactgtatccgagactgcagcttttgccttaggatatggcatcaattaggcttcactaattatga |
36186100 |
T |
|
| Q |
219 |
gttcatctc |
227 |
Q |
| |
|
|||| |||| |
|
|
| T |
36186099 |
gttcttctc |
36186091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 120 - 221
Target Start/End: Original strand, 21377090 - 21377191
Alignment:
| Q |
120 |
ttctcgttgcagtcttaaaaacgaaatttttcttcaatgtgtacgagattgcagcttttgccttaggatatggcatcaattaggcttcattaattatgag |
219 |
Q |
| |
|
|||||||||||||||| | || || | |||||||| ||||| |||| |||| ||||| ||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
21377090 |
ttctcgttgcagtcttcagaatgagacctttcttcattgtgtttgagactgcaacttttcccttaggatatggcatcaatttggcttcactaattctgag |
21377189 |
T |
|
| Q |
220 |
tt |
221 |
Q |
| |
|
|| |
|
|
| T |
21377190 |
tt |
21377191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University