View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2500_high_4 (Length: 409)
Name: NF2500_high_4
Description: NF2500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2500_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 1 - 392
Target Start/End: Complemental strand, 16509903 - 16509527
Alignment:
| Q |
1 |
cttcaaaaccctaacttcatcactcacagctgctttccctttcaccaccttcaacacttccacttcatcatcacaaacggttttcttctctgcacaaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16509903 |
cttcaaaaccctaacttcatcactcacagcttctttccccttcaccaccttcaacacttccacttcatcatcacaaacggttttcttctctgcacaaacc |
16509804 |
T |
 |
| Q |
101 |
ggttcagccaatgttggttgtttaactggttcaaccttaaccggttcaaccttaaccggctcaaccttaaccggttcaaccataaccgattcttgtgtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
16509803 |
ggttcagccaatgttggttgtttaaccggtccaaccttaaccggttcaaccttaaccgg---------------ttcagccataaccgattcttgtgtat |
16509719 |
T |
 |
| Q |
201 |
cgcaaaccacattgagattaggaacttcatccaatgatttcaccgattcttgcgtctcgaaaaccacatcaacatcagaactttctaccttcgtttgaac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
16509718 |
cgcaaaccacattgagattaggaacttcttccattgatttcaccgattcttgcgtctcaaaaactacatcaacatcagaactttctaccttcatttgaat |
16509619 |
T |
 |
| Q |
301 |
cgttgattcagcctccattgatttcatcgattcatcaacagaagcaactttcgtgttcgtagctttcaaaaaatcatcgaacgcaagcatcg |
392 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16509618 |
cgttgattcagcttccattgatttcaacgattcatcaacagaagcaactttcgtgttcgtagctttcaaaaaatcatcgaacgcaagcatcg |
16509527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University