View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2500_low_9 (Length: 236)
Name: NF2500_low_9
Description: NF2500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2500_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 24885579 - 24885802
Alignment:
| Q |
1 |
taggatcaaattttaatcaaggatttaaatttcaactagattagatttgtatggtgcc-ttcctccccaattttgtctcttcattaaataatgaagtgag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24885579 |
taggatcaaattttaatcaaggatttaaatttcaactagattagatttgtatggtgcccttcctccccaaatttgtctcttcattaaataatgaagtgag |
24885678 |
T |
 |
| Q |
100 |
gactttaagtgtcgttttactttggggatctatgagtgatcgttctaatcgttatgcgggggtatacattctaaacattcatgtctaatagtaggttatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24885679 |
gactttaagtgtcgttttactttggggatctatgagtgatcgttctaatcattatgcgggggtatacattataaacattcatgtctaatagtaggttatt |
24885778 |
T |
 |
| Q |
200 |
tcgaacatgtgttcgaggatattg |
223 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
24885779 |
tcgaacatgtgttcgaagatattg |
24885802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 93 - 149
Target Start/End: Complemental strand, 30438336 - 30438280
Alignment:
| Q |
93 |
aagtgaggactttaagtgtcgttttactttggggatctatgagtgatcgttctaatc |
149 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
30438336 |
aagtgaagactttaagtgttattttactttggggatctagatgtgatcgttctaatc |
30438280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University