View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2501_high_22 (Length: 250)
Name: NF2501_high_22
Description: NF2501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2501_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 55 - 233
Target Start/End: Complemental strand, 36361632 - 36361456
Alignment:
| Q |
55 |
ctaatataagcatttgaagataaaatatagcgtttttccttattcactcgaaagacttaatctattctaatcaactagttaagtaactattttaattagc |
154 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36361632 |
ctaatataagcatttgaagataaaatagag--tttttccttattcactcgaaagacttaatctattctaatcaactaattaagtaactattttaattagc |
36361535 |
T |
|
| Q |
155 |
acttcttcaagtgtttagtattgtttatcaaagcctcattagactctctctaataataaggcttaattgcagttttggc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36361534 |
acttcttcaagtgtttagtattgtttatcaaagcctcattagactctctctaataataaggcttaattggcgttttggc |
36361456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Complemental strand, 1096622 - 1096594
Alignment:
| Q |
205 |
taataataaggcttaattgcagttttggc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1096622 |
taataataaggcttaattgcagttttggc |
1096594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University