View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2501_high_29 (Length: 215)
Name: NF2501_high_29
Description: NF2501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2501_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 64 - 200
Target Start/End: Complemental strand, 14076720 - 14076584
Alignment:
| Q |
64 |
ttacccatccaaaatcccttataccatttaacccaccattggaccactgccattgtcttatacctctacacaacatcaatgatnnnnnnnntcgaccaca |
163 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14076720 |
ttacccatccaaaatcccttatcccatttaacccaccattggaccactgccattgtcttatacctctacacaacatcaatgataaaaaaaatcgaccaca |
14076621 |
T |
 |
| Q |
164 |
tcactctatcaatgtctccacattgtccgtgaaatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14076620 |
tcactctatcaatgtctccacattgtccgtgaaatat |
14076584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 44
Target Start/End: Complemental strand, 14077001 - 14076971
Alignment:
| Q |
14 |
aaaatcacaaatttgagctgccataattatg |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14077001 |
aaaatcacaaatttgagctgccataattatg |
14076971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University