View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2501_low_12 (Length: 412)
Name: NF2501_low_12
Description: NF2501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2501_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 9e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 226 - 385
Target Start/End: Complemental strand, 32496852 - 32496693
Alignment:
| Q |
226 |
acttgatattgtttttacagaaatttaagcggttggggttggttaagaatcggttaattacccgttgtacttctgggtctgatgaatttggttctcttaa |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32496852 |
acttgatattgtttttacagaaatttaagcggttggggttggttaagaatcggttaattacccgttgtacttctgggtctgatgaatttggttgtcttaa |
32496753 |
T |
 |
| Q |
326 |
tggaattcagttaacacctaataaacttttcgtccaagaggtaactctactactcatttt |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32496752 |
tggaattcagttaacacctaataaacttttcgtccaagaggtaactctactactcatttt |
32496693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 32497071 - 32496981
Alignment:
| Q |
8 |
acatcatcatcttctacttctctccgtaacaacaacgttgttgcgtgacgaacaacaatgaactccactactttctccaactgcagagcca |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32497071 |
acatcatcatcttctacttctctccgtaacaacaacgttgttgcgtgtcgaacaacaatgaactccactactttctccaactgcagagcca |
32496981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University