View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2501_low_26 (Length: 303)
Name: NF2501_low_26
Description: NF2501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2501_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 14 - 288
Target Start/End: Original strand, 47433015 - 47433289
Alignment:
| Q |
14 |
tactgctacgcatgactgttaatgccaaagggagcttttttcatcgttatagaggtgcttaaatccttctccttctctgtctaatgcatcatgcatggat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47433015 |
tactgctacgcatgactgttaatgccaaagggagcttttttcaccgttatagaggtgcttaaatccttctccttctctgtctaatgcatcatgcatggat |
47433114 |
T |
|
| Q |
114 |
atgaagtgctgattttgaaacattatatcttagtggttgcattgcagataaaatttgtagagaggtggaatgtggaaaaggaaagtgtggggctacatcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47433115 |
atgaagtgctgattttgaaacattatatcttagtggttgcattgcagataaaatttgtagagaggtggaatgtggaaaaggaaagtgtggggctacatcc |
47433214 |
T |
|
| Q |
214 |
actcacaaaaacccatttaatgtattctgtgaatgtgagcctggatggcagaaaatcaaagtggaccctgattat |
288 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47433215 |
actcacaaaaacccatttagtgtattctgtgaatgtgagcctggatggcagcaaatcaaagtggaccctgattat |
47433289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University