View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2501_low_30 (Length: 266)
Name: NF2501_low_30
Description: NF2501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2501_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 43540615 - 43540380
Alignment:
| Q |
12 |
atgaaggaatgcggatgcaaaccaacaactagtacttttaatactctcattaaaggattcggaattgttggaaggcctcatgaagccatgaaattgctag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540615 |
atgaaggaatgcggatgcaaaccaacaactagtacttttaatactctcattaaaggattcggaattgttggaaggcctcatgaagccatgaaattgctag |
43540516 |
T |
|
| Q |
112 |
agatgatgattcaggatggaaatgtgaaaccgaacgagagaacatataatattctcatccaagcatggtgtaccaagaatgaattggaagaggcatggaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540515 |
agatgatgattcaggatggaaatgtgaaaccgaatgagagaacatataatattctcatccaagcatggtgtaccaagaatgaattggaagaggcatggaa |
43540416 |
T |
|
| Q |
212 |
tgttatgcataaaatggtgaactctggcatgcagcc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540415 |
tgttatgcataaaatggtgaactctggcatgcagcc |
43540380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University