View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2501_low_35 (Length: 250)
Name: NF2501_low_35
Description: NF2501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2501_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 5461562 - 5461316
Alignment:
| Q |
1 |
ttttccaatggctggtgttggaaatctcatggtatgtttgcagacaccattcttagtaaattattaggtcaatgatctcgaatatgaaaaaacaagtcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5461562 |
ttttccaatggctggtgttggaaatctcatggtatatttgcagacaccattcttagtaaattattaggtcaatgatctcgaatatgaaaaaacaagtcta |
5461463 |
T |
|
| Q |
101 |
ccttcataacttttttacggtaacgctgtaattttgttaaaattttaaagtgtagtttttataatcgtgattttgtcaaacttactttcgatccaaaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5461462 |
ccttcataacttttttacggtaacgctgtaattttgttaaaattttaaagtgtagtttttatcatcgtgattttgtcaaacttactttcaatccaaaata |
5461363 |
T |
|
| Q |
201 |
tatgtttgaaatcgcagtaagtttgacaaaattatcgacactataat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5461362 |
tatgtttgaaatcgcagtaagtttgacaaaattatcgacactataat |
5461316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University