View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2501_low_40 (Length: 236)
Name: NF2501_low_40
Description: NF2501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2501_low_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 162
Target Start/End: Original strand, 1300216 - 1300366
Alignment:
| Q |
12 |
agcaaaggtggatcggtagttgatggaaatttcgtatattttattttttcatcattacgttcagccaaattctttggacttactttccgacttaggggtg |
111 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1300216 |
agcaatggtggatcggtagttggtggaaatttcgtatattttattttttcatcattacgttcagccaaattctttggacttactttccgacttaggggtg |
1300315 |
T |
 |
| Q |
112 |
ttcatagtcacggagattaattgttgaatgcaaataatattaaagaatctc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1300316 |
ttcatagtcacggagattaattgttgaatgcaaataatattaaagaatctc |
1300366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 46 - 105
Target Start/End: Original strand, 1286401 - 1286460
Alignment:
| Q |
46 |
tatattttattttttcatcattacgttcagccaaattctttggacttactttccgactta |
105 |
Q |
| |
|
|||| ||||||||||||||||||| || ||| |||||||||||||||||||||||||||| |
|
|
| T |
1286401 |
tatactttattttttcatcattacatttagctaaattctttggacttactttccgactta |
1286460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University