View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2501_low_48 (Length: 202)
Name: NF2501_low_48
Description: NF2501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2501_low_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 17 - 139
Target Start/End: Original strand, 34719383 - 34719505
Alignment:
| Q |
17 |
aagaaattattaatccaatcattaatatggggtcatatgctgatttgaaaaattggaaaagtgccgtttatgtaaccttggacttcaaaagatattgtgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34719383 |
aagaaattattaatccaatcattaatatggggtcatatgctgatttgaaaaattggaaaagtaccgtttatgtaaccttggacttcaaaagatattgtgt |
34719482 |
T |
|
| Q |
117 |
tgaagggtgatgatttctacgtt |
139 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34719483 |
tgaagggtgatgatttctacgtt |
34719505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University