View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2501_low_49 (Length: 201)
Name: NF2501_low_49
Description: NF2501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2501_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 38277178 - 38276992
Alignment:
| Q |
1 |
ggcagcctatagcaggccgtatataataataagcataagattatctgagttttaat-gtnnnnnnnnntgtaattccatttctttatattcatataatag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||| ||| |
|
|
| T |
38277178 |
ggcagcctatagcaggccgtatataataataagcataagattctctgagttttaatagtaaaaaaaatagtaattccatttctttatattcatatactag |
38277079 |
T |
 |
| Q |
100 |
acccatgtcatcaatgggaaatagctgctgataa-aaaatggattcaaatgcattaatgtaagctgaagaactaatcaagtgatatt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38277078 |
acccatgtcatcaatgggaaatagctgctgataaaaaaatggattcaaatgcattaatgtaagctgaagaactaatcaagtgatatt |
38276992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University