View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2502_high_9 (Length: 256)
Name: NF2502_high_9
Description: NF2502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2502_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 30620922 - 30620700
Alignment:
| Q |
18 |
gaaaagccaggatcgttgccaccaaacgttgcagcagcagttaatggcgttgcttttgttgggacactttctggacaactctttttcggctggctcggtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30620922 |
gaaaagccaggatcgttgccaccaaacgttgcagcagcagttaatggcgttgcttttgttgggacactttctggacaactcttcttcggctggctcggtg |
30620823 |
T |
 |
| Q |
118 |
acaaactaggccgtaaaaaagtctatggcatgactctagctgttatggttgtttgttccataggttcgggtctttcatttggacatgaaccaaaaacagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30620822 |
acaaactaggccgtaaaaaagtctatggcatgactctagctgttatggttgtttgttccataggttctggtctttcatttggacatgaaccaaaaacagt |
30620723 |
T |
 |
| Q |
218 |
gttgggaactctttgcttcttca |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30620722 |
gttgggaactctttgcttcttca |
30620700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 33 - 240
Target Start/End: Complemental strand, 30616156 - 30615949
Alignment:
| Q |
33 |
ttgccaccaaacgttgcagcagcagttaatggcgttgcttttgttgggacactttctggacaactctttttcggctggctcggtgacaaactaggccgta |
132 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||| | ||||| ||||| ||| || | ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30616156 |
ttgccaccaaacgttgcagcaacagttaacggcctcgctttagttggaacatttaccggacaactcttcttcggctggctcggtgacaaactaggccgta |
30616057 |
T |
 |
| Q |
133 |
aaaaagtctatggcatgactctagctgttatggttgtttgttccataggttcgggtctttcatttggacatgaaccaaaaacagtgttgggaactctttg |
232 |
Q |
| |
|
|| ||||||||| || |||||| ||||| || |||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30616056 |
gaacagtctatggaatcactctaaacattatgattatttgttccctaggttctggtctttcatttggacatgaaccaaaaatggtgttgggaactctttg |
30615957 |
T |
 |
| Q |
233 |
cttcttca |
240 |
Q |
| |
|
|||||||| |
|
|
| T |
30615956 |
cttcttca |
30615949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University