View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2502_low_15 (Length: 232)
Name: NF2502_low_15
Description: NF2502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2502_low_15 |
 |  |
|
| [»] scaffold0221 (1 HSPs) |
 |  |  |
|
| [»] scaffold0597 (1 HSPs) |
 |  |  |
|
| [»] scaffold0996 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 22127966 - 22127869
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22127966 |
gatccccctaatgttcaaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatctaccttctgcttattcaa |
22127869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 20850652 - 20850619
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatt |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20850652 |
gatccccctaatgttccaaaaaataatcttcatt |
20850619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 18740080 - 18740177
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
18740080 |
gatccccctaatgttccaaaaaataatcttcatttagaggttggaagaggaccctgtgaacgggttttggtttgaaaatctaccttctgcttattcaa |
18740177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 18741317 - 18741410
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttat |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
18741317 |
gatcctcctaatgttccaaaaaataatcttcatttagaggttggaagaggaccctgtgaacgggttttggtttgaaagtctaccttctgcttat |
18741410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 22459649 - 22459551
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaa-taatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| |||| ||||||||||| ||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
22459649 |
gatcccccaaatgttccaaaaaaataatcttcatttagatgttggaagaggaccctatgaacgggttttggtttgaaaatctaccttctccttattcaa |
22459551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 21345830 - 21345927
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21345830 |
gatcctcctaatgttcaaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatctaccttctgcttattcaa |
21345927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 25 - 98
Target Start/End: Complemental strand, 39198977 - 39198904
Alignment:
| Q |
25 |
aatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
39198977 |
aatcttcatttagaggttggaagaggaccctgtgaacgggttttggtttgaaaatctaccttctgcttattcaa |
39198904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 25 - 77
Target Start/End: Original strand, 47399585 - 47399637
Alignment:
| Q |
25 |
aatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaa |
77 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
47399585 |
aatcttcatttagaggttggaagaggaccctgtgaacgggttttggtttgaaa |
47399637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0221 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 14520 - 14617
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||| |||||||| ||||||||| |
|
|
| T |
14520 |
gatcctcctaatgttccaaaaaataatcttcatttagaggttggaagaggaccctgtgaacgggttttggtttaaaaatctaccttctacttattcaa |
14617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 2 - 98
Target Start/End: Complemental strand, 15498398 - 15498301
Alignment:
| Q |
2 |
atccccctaatgttccaaaaaa-taatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
15498398 |
atcccccaaatgttccaaaaaaataatcttcatttagaggttggaagaggaccctgtgaacgggttttggtttgaaaatctaccttctgcttattcaa |
15498301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 32135399 - 32135496
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||| ||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
32135399 |
gatccccctaatgttccaaaaaataatcttcattgagagtttgggagaggaccctgtgaccgggttttggtttgaaaatctaccttctgcttattcaa |
32135496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 153 - 213
Target Start/End: Original strand, 15464540 - 15464600
Alignment:
| Q |
153 |
aatatataagaaaagggactgaaatgtttttgcagtttccaactgtcacaaataatacgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
15464540 |
aatatataagaaaagggactgaaatgttttagtagtttccaactgtcacaaataatacgag |
15464600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 22025539 - 22025572
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatt |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
22025539 |
gatccccctaatgttccaaaaaataatcttcatt |
22025572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 12397411 - 12397465
Alignment:
| Q |
11 |
atgttccaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggt |
65 |
Q |
| |
|
|||||||||||||| || |||||||| ||| |||| |||||||||| |||||||| |
|
|
| T |
12397411 |
atgttccaaaaaattatattcatttaaagggtgaacgaggaccctgagaacgggt |
12397465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0597 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: scaffold0597
Description:
Target: scaffold0597; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 7180 - 7277
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||| |||||||| |||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
7180 |
gatcccactaatgttccaaaaaataatcttcattaagaggttggcagaggaccgtgtgaatgggttttggtttgaaaatctaccttctgcttattcaa |
7277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0996 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: scaffold0996
Description:
Target: scaffold0996; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 3500 - 3403
Alignment:
| Q |
1 |
gatccccctaatgttccaaaaaataatcttcatttagaggttgaaagaggaccctgtgaacgggtcttggtttgaaaatttaccttctgcttattcaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| | || ||||||||||||||| ||||| || ||||||||||||||| | ||||||||||| |
|
|
| T |
3500 |
gatccccctaatgttccaaaaaataatcttcattgagatggtggaagaggaccctgtgagcgggttttagtttgaaaatttaccgtttgcttattcaa |
3403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University