View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2503_high_5 (Length: 340)
Name: NF2503_high_5
Description: NF2503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2503_high_5 |
 |  |
|
| [»] scaffold0040 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0040 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 93
Target Start/End: Complemental strand, 41837 - 41762
Alignment:
| Q |
18 |
ataacgactttagctaagtcattcttgtgtttgataagtccaagttagctggtggcaatttctttttctgtgttgt |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41837 |
ataacgactttagctaagtcattcttgtgtttgataagtccaagttagctggtggcaatttctttttctgtgttgt |
41762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University