View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2503_low_16 (Length: 239)
Name: NF2503_low_16
Description: NF2503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2503_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 32908108 - 32907891
Alignment:
| Q |
1 |
atgtgtagctcaagttctacaatcaaatagaatggagcacaatattattgaggaaaacagtcatcaatttatacagacaagattaagttttcacataaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32908108 |
atgtgtagctcaagttctacaatcaaatagaacggagcacaatattattgaggaaaacagtcatcaatttatacagacaagatgaagttttcacataaca |
32908009 |
T |
 |
| Q |
101 |
agagctcacatgaagaagattaagaaaacttaagcaacaaagagacagcagctcggaccattaatattattgagccaactctaaagataatgcggctcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32908008 |
agagctcacatgaagaagattaagaaaacttaagcaacaaagagacagcagctcggaccattaa---tattgagccaactctaaagataatgcggctcaa |
32907912 |
T |
 |
| Q |
201 |
tttgtaagtttaaatctcttc |
221 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
32907911 |
tttgtaagttttaatctcttc |
32907891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University