View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2503_low_4 (Length: 493)
Name: NF2503_low_4
Description: NF2503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2503_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 4e-82; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 19 - 177
Target Start/End: Original strand, 45688105 - 45688263
Alignment:
| Q |
19 |
gggattctcttggactccaccgtttatgggtcgaaccggttcgagttggtcgaagaataagtcacctgggaaaatggatgatgttggagaacggtcttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45688105 |
gggattctcttggactccaccgtttatgggtcgaaccggttcgagttggtcgaagaataagtcacctgggaaaatggatgatgttggagaacggtcttct |
45688204 |
T |
|
| Q |
119 |
gatcgattgtttgaaggtaatcggggttagttgggtaggtattgtttgatgaaaatttt |
177 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45688205 |
gatcggttgtttgaaggtaatcggggttagttgggtaggtattgtttgatgaaaatttt |
45688263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 197 - 325
Target Start/End: Original strand, 45688292 - 45688408
Alignment:
| Q |
197 |
aaagaatataccgttgaaatacagatgaagattgtgtttataatttatttaatttaatgtaatgtggaatattgtttaggttttgtgggtggaattacga |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45688292 |
aaagaatataccgttgaaatacagatgaagattgtgtttat------------ttaatgtaatgtggaatattgtttaggttttgtgggtggaattacga |
45688379 |
T |
|
| Q |
297 |
aagtggatagaatttgttcctgaatgaag |
325 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
45688380 |
aagtggatagaatttgttcatgaatgaag |
45688408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 392 - 426
Target Start/End: Original strand, 45688466 - 45688500
Alignment:
| Q |
392 |
agtttcatcgccgctttcatgtaaaattgattagc |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45688466 |
agtttcatcgccgctttcatgtaaaattgattagc |
45688500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University