View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_high_26 (Length: 327)
Name: NF2504_high_26
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 10692160 - 10691859
Alignment:
| Q |
1 |
tttggttttgggttgaactctctggtcttgcttagttgaggttgttgaggtgagacagcaaaacacacaacacgaagcaaagaaggtattcacgattcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10692160 |
tttggttttgggttgaactctctggtcttggttagttgaggttgttgaggtgagacagcaaaacacacaacacgaagcaaagaaggtattcacgattcgg |
10692061 |
T |
 |
| Q |
101 |
tattggtcggtttgtaagtatgtttgctttggtcgttggctgcgtgcgtgtgttgggctaatgttccaccttctttcaaagtggaatatatacgcaatgg |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
10692060 |
tattggtcggtttgtaaatatgtttgctttggtcgttggctgcgtgcgtgtgttggactaatgttccaccttctttcaaagtggaatatatatggaatgg |
10691961 |
T |
 |
| Q |
201 |
cttatgccaacg-------atcaaatttgtccttgaatttacaaaagaccaatcaaattcatcccccaannnnnnnaaatatcaagttagtccattaatt |
293 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||| ||||| ||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
10691960 |
cttatgccaacgaataatcatcacattcgtccttgaatttac-aaagaacaatcaaattcat-ccccaaattttttaaatatcaagttagtccattaatt |
10691863 |
T |
 |
| Q |
294 |
taac |
297 |
Q |
| |
|
|||| |
|
|
| T |
10691862 |
taac |
10691859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University