View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_high_30 (Length: 297)
Name: NF2504_high_30
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 112 - 207
Target Start/End: Original strand, 21832402 - 21832497
Alignment:
| Q |
112 |
cgtaaatataacctaactccaaggatcattcagtaacgcaacagtacaaccataacctaactacaaaccctaacatttgtttcaccatccgttacc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21832402 |
cgtaaatataacctaactccaaggatcattcagtaacgcaacagtacaaccataacctaactacaaaccctaacatttgtttcaccatctgttacc |
21832497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 213 - 276
Target Start/End: Original strand, 21832797 - 21832860
Alignment:
| Q |
213 |
caaacccgtaacaataaaaacataacctaactccaaaccctaatatttttgtgtcaccgccagc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832797 |
caaacccgtaacaataaaaacataacctaactccaaaccctaatatttttgtgtcaccgccagc |
21832860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 21832293 - 21832347
Alignment:
| Q |
1 |
gaaataagtgttgccgataatccatttcctaattgaatgaagttgaattttatgt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21832293 |
gaaataagtgttgccgataatccatttcccaattgaatgaagttgaattttatgt |
21832347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University