View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_high_58 (Length: 232)
Name: NF2504_high_58
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_high_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 69 - 203
Target Start/End: Original strand, 26259007 - 26259139
Alignment:
| Q |
69 |
tatagtaattgtaattctcatcccaacttgagagattaatgtatgatgttgaaccaagagggcattcaattnnnnnnnnnnnnggaaatgtattagttca |
168 |
Q |
| |
|
|||| ||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
26259007 |
tataataattgtaattctcatcccgactcgagagattaatgtatgatgttgtaccaagagggcattcaatt--taaaaaaaaaggaagtgtattagttca |
26259104 |
T |
 |
| Q |
169 |
ttaatttcattaacttgctactattaataactagt |
203 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26259105 |
ttaatttcattaacttgctgctattaataactagt |
26259139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 38002997 - 38002938
Alignment:
| Q |
1 |
aaaaactagagggaatgtcagttctatttaataataccttaagggaggcgagtgtaattt |
60 |
Q |
| |
|
||||||||||||| |||| ||| |||||||| || |||| |||||||| ||||||||||| |
|
|
| T |
38002997 |
aaaaactagaggggatgttagtgctatttaagaaaacctaaagggaggtgagtgtaattt |
38002938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University