View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_12 (Length: 518)
Name: NF2504_low_12
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 92 - 341
Target Start/End: Original strand, 50550327 - 50550576
Alignment:
| Q |
92 |
gtgtgcgttgatctactttgattggggtgccaatggcagaagctagcaccagaagaacgctttcatcatagtaaatcaagctcatccctgggaaacgaac |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50550327 |
gtgtgcgttgatctactttgattggggtgccaatggcagaagctagcaccagaagaacgctttcatcatagtaaatcaagctcatgcctgggaaacgaac |
50550426 |
T |
|
| Q |
192 |
ccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccgggctccatttagcaacagcaaggtagtgatcaaagatcatccacggaccctct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||| |||||||| |
|
|
| T |
50550427 |
ccaaaccatcgtcttttcaatcttagcagtggatgatacgaactccaggctccatttagcaacagtaaggtaatgatcaaagatcatccacagaccctct |
50550526 |
T |
|
| Q |
292 |
ccaatgactttatctctatcttcagccatgtcaaacttcatcatataaaa |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50550527 |
ccaatgactttatctctatcttcagccatgtcaaacttcatcgtataaaa |
50550576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University