View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_28 (Length: 371)
Name: NF2504_low_28
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 1 - 357
Target Start/End: Complemental strand, 2222291 - 2221935
Alignment:
| Q |
1 |
ttgattttgtctaagaacgaggttgtaagagtcaatgcacttgcttcattggtcaacctttcacttgagaaagttaacaaagtgaagatagtccggtcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222291 |
ttgattttgtctaagaacgaggttgtaagagtcaatgcacttgcttcattggtcaacctttcacttgagaaagttaacaaagtgaagatagtccggtcag |
2222192 |
T |
|
| Q |
101 |
gaattgttccaccgttgattgaggttttgaggtttgggtcgtgtgaatcgcaggaacatgcttcgtgtgcgatgtttagtttagcgcttgatgatgataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222191 |
gaattgttccaccgttgattgaggttttgaggtttggatcgtgtgaatcgcaggaacatgcttcgtgtgcgatgtttagtttagcgcttgatgatgataa |
2222092 |
T |
|
| Q |
201 |
taaaactgcgattggtgttttaggtgctcttttgccattgcttcacgcgcttaaatcagagagtgaaaagacgcgccatgactcgggtttggcactttgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222091 |
taaaactgcgattggtgttttaggtgctcttttgccattgcttcacgcgcttaaatcagagagtgaaaagacgcgccatgactcgggtttggcactttgt |
2221992 |
T |
|
| Q |
301 |
catttgtctttagtgaggagtaatcgggctaagatggttaagctagggtttgtttcg |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2221991 |
catttgtctttagtgaggagtaatcgggctaagatggttaagctagggtttgtttcg |
2221935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 143 - 228
Target Start/End: Complemental strand, 35294456 - 35294371
Alignment:
| Q |
143 |
gtgaatcgcaggaacatgcttcgtgtgcgatgtttagtttagcgcttgatgatgataataaaactgcgattggtgttttaggtgct |
228 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||||||||| || | |||||||||||||| | || ||||||||| | |||||| |
|
|
| T |
35294456 |
gtgaatcgcaggaacatgctgcgggtgcgttgtttagtttggctttggatgatgataataagatggcaattggtgttcttggtgct |
35294371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University