View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_29 (Length: 369)
Name: NF2504_low_29
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 144 - 356
Target Start/End: Complemental strand, 40192749 - 40192537
Alignment:
| Q |
144 |
atattatttttattttcccattataatgctctaagcctcttaactatattttcttttagagtagaggaattaccaaagtacccattccaaatgtagtaat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192749 |
atattatttttattttcccattataatgctctaagcctcttaactatattttcttttagagtagaggaattaccaaagtacccattccaaatgtagtaat |
40192650 |
T |
|
| Q |
244 |
gaagaaggcggctataaaggatattataggaaacaaaattgnnnnnnnccggtaaactgtcccttatataaaaaagcaacatctcatgtacttctctact |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192649 |
gaagaaggcggctataaaggatattataggaaacaaaattgaaaaaaaccggtaaactgtcccttatataaaaaagcaacatctcatgtacttctctact |
40192550 |
T |
|
| Q |
344 |
ttagtttggtcct |
356 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40192549 |
ttagtttggtcct |
40192537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 65 - 152
Target Start/End: Complemental strand, 40193553 - 40193466
Alignment:
| Q |
65 |
tatgagtcatactcaacgattattgcaatcaaaccaacataatatttcatgtgtctcaatataaatcatttttgagcaaatattattt |
152 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193553 |
tatgagtcatactcaacgatcattgcaatcaaaccaacataatatttcatgtgtctcaatataaatcatttttgagcaaatattattt |
40193466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 40193645 - 40193597
Alignment:
| Q |
18 |
cttctatgttatttatgaattaaggttacttagattgcaactgaattta |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40193645 |
cttctatgttatttatgaattaaggttacttagattgtaactgaattta |
40193597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University