View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_33 (Length: 345)
Name: NF2504_low_33
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 16 - 327
Target Start/End: Complemental strand, 28146687 - 28146376
Alignment:
| Q |
16 |
gcaaagggacaattaaggaatagatgagatgcattttcttgttgcttgcagcataagttacacattgaaggaaaactgcatcccctctctgcaagattct |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28146687 |
gcaaagggactattaaggaatagatgagatgcattttcttgttgcttgaagcataagttacacattgaaggaaaactgcatcccttctctgcaagattct |
28146588 |
T |
 |
| Q |
116 |
catcagtgggaatcttctcctgattcattctctaaactgtgaaacttaggcatcttctttttgctcaaggtgggatagctatgaggtaaatgtgattcat |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28146587 |
catcagtgggaatcttctcgtgattcattctctaaactgtgaaacttaggcatcttctttttgctcaaggtgggatagctatgaggtaaatgtgattcat |
28146488 |
T |
 |
| Q |
216 |
caaatttaggaaagtaatttgaagatccattggaatattcattctattcaaaatttactaaataatcattaacactttaattaagaaaaaactccaattt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28146487 |
caaatttaggaaagtaatttgaagatccattggaatattcattctattcaaaatttactaaataatcattaacactttaattaagaaaaaactccaattt |
28146388 |
T |
 |
| Q |
316 |
atagattcaaaa |
327 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28146387 |
atagattcaaaa |
28146376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University