View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_34 (Length: 333)
Name: NF2504_low_34
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 2 - 322
Target Start/End: Complemental strand, 34655713 - 34655393
Alignment:
| Q |
2 |
aaatgcagtgttcaggtcttttgtctattgttgctctcagttgttccccagacttcaacatgaatcccctcttctgcccctgcccccaatttaaggcaag |
101 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34655713 |
aaatgcagtgttcaggtcttttgcctattgttgctctcagttgttccccagacttcaacaagaatcccctcttctgcccctgcccccaatttaaggcaag |
34655614 |
T |
|
| Q |
102 |
cctctatccatctaacaactgaacaattttaattgacattttccatctatctaatctaactgctctaagcctgaaactgcagtgnnnnnnnaatgacaat |
201 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34655613 |
cctctatccatctaacaaccgaacaattttaattgacattttccatctatctaatctaactgctctaagcctgaaactgcagtgtttttttaatgacaat |
34655514 |
T |
|
| Q |
202 |
tagttgttacagatattaacgaagggattgaacccacaaacactaatcactccaaccctaataattttcctctgatccaccaaatcgctctatcattctg |
301 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34655513 |
tagttgttacaaatattaacgaagggattgaacccacaaccactaatcactccaaccctaataattttcctctgaaccaccaaatcgctctatcattctg |
34655414 |
T |
|
| Q |
302 |
cctcttctattggcttccttt |
322 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34655413 |
cctcttctattggcttccttt |
34655393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University