View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_35 (Length: 332)
Name: NF2504_low_35
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 20 - 313
Target Start/End: Complemental strand, 194396 - 194103
Alignment:
| Q |
20 |
aaggaagcacatgattgaatccaaagcaaagcagaagggagggaaagggattgagcaacatcagaaacccatagaatgaaaggattattaatcaaacatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
194396 |
aaggaagcacatgattgaatccaaagcaaagcagaagggagggaaagggattgagcaacatcagaaacccatggaatgaaaggattgttaatcaaacatg |
194297 |
T |
|
| Q |
120 |
agacaggtggattttgttgggagattatggtagggaggacttgtttcccaaccctctctagctgtggcaaatacacatccaagtcaagccgttttggttc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194296 |
agacaggtggattttgttgggagattatggtagggaggacttgtttcccaaccatctctagttgtggcaaatacacatccaagtcaagccgttttggttc |
194197 |
T |
|
| Q |
220 |
attctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcctatcacaacttccttctcttcttctaaatctctagcttttctc |
313 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194196 |
atcctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcctatcacaacttccttctcttcttctaaatctctagcttttctc |
194103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University