View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2504_low_44 (Length: 297)

Name: NF2504_low_44
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2504_low_44
NF2504_low_44
[»] chr4 (3 HSPs)
chr4 (112-207)||(21832402-21832497)
chr4 (213-276)||(21832797-21832860)
chr4 (1-55)||(21832293-21832347)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 112 - 207
Target Start/End: Original strand, 21832402 - 21832497
Alignment:
112 cgtaaatataacctaactccaaggatcattcagtaacgcaacagtacaaccataacctaactacaaaccctaacatttgtttcaccatccgttacc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
21832402 cgtaaatataacctaactccaaggatcattcagtaacgcaacagtacaaccataacctaactacaaaccctaacatttgtttcaccatctgttacc 21832497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 213 - 276
Target Start/End: Original strand, 21832797 - 21832860
Alignment:
213 caaacccgtaacaataaaaacataacctaactccaaaccctaatatttttgtgtcaccgccagc 276  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21832797 caaacccgtaacaataaaaacataacctaactccaaaccctaatatttttgtgtcaccgccagc 21832860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 21832293 - 21832347
Alignment:
1 gaaataagtgttgccgataatccatttcctaattgaatgaagttgaattttatgt 55  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
21832293 gaaataagtgttgccgataatccatttcccaattgaatgaagttgaattttatgt 21832347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University