View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_49 (Length: 285)
Name: NF2504_low_49
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 277
Target Start/End: Original strand, 12565448 - 12565706
Alignment:
| Q |
19 |
tagttaatatcattaccgaattttatgcatcgtgaatcgtgatatgaaaccaaatgacatttttactatagatctcatatttactccaatagtaattgca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12565448 |
tagttaatatcattaccgaattttatgcatcgtgaatcgtgatatgaaaccaaatgacatttttactatagatctcatatttactccaatagtaattgca |
12565547 |
T |
 |
| Q |
119 |
taaatacacatcacatgtctttcattcaacactagtcaacactttagatgcaatagagtagttatggaatgttcatgaatgactatgactctttaatgca |
218 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| | |
|
|
| T |
12565548 |
taaatacacatcacatgccttccattcaacactagtcaacactttagatgcaatagagtagttatgaaatgttcatgaatgactatgactttttaatgta |
12565647 |
T |
 |
| Q |
219 |
aagcttgcttcaattttggaaggcaaaaaatgcaatactcttttgaatcaattgatgat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
12565648 |
aagcttgcttcaattttggaaggcaaaaaatgcaatactcttttgaatgaattgctgat |
12565706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University