View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_55 (Length: 258)
Name: NF2504_low_55
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_55 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 8133714 - 8133601
Alignment:
| Q |
129 |
ctcttcggtcacattgacaaacctcattgtttgcaatcaagtcatgtcttaactaccaaacattgttctatcaaactccctgggcatcaatagtgtttga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
8133714 |
ctcttcggtcacattgacaaacctcattgtttgcaatcaagtcatgtcctaactaccaaacatcgttctattaaactccctgggcatcaatagtgtatga |
8133615 |
T |
 |
| Q |
229 |
ttgaacgataattt |
242 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8133614 |
ttgaacgataattt |
8133601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 10 - 69
Target Start/End: Complemental strand, 8133834 - 8133775
Alignment:
| Q |
10 |
ataatactagcatataaaacgaaagttagggtttacaaaacacatagtaacatgacattc |
69 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8133834 |
ataatactagcatataaaacgaacgttagggtttacaaaacacatagtaacatgacattc |
8133775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 152 - 242
Target Start/End: Complemental strand, 8151625 - 8151534
Alignment:
| Q |
152 |
tcattgtttgcaatcaagtcatgtcttaactaccaaacattg-ttctatcaaactccctgggcatcaatagtgtttgattgaacgataattt |
242 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||| ||||||||| | ||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
8151625 |
tcattgtttgcaatcaagtcatgcgctgactaccaaacaacccttctatcaacccccctgggaatcaatagagtttgattgaacgataattt |
8151534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University