View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_56 (Length: 256)
Name: NF2504_low_56
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 4 - 239
Target Start/End: Original strand, 32086757 - 32086993
Alignment:
| Q |
4 |
gatggacatcatcattttttaaaaacgaaattgtattatttgtataataatgctgccctatttgattggtgtaggggtgagttggatccacaatgcagtt |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32086757 |
gatgcacatcatcattttttaaaaacgaaattgtattatttgtataataatgctgccctatttgattggtgtaggggtgagttggatccacaatgcagtt |
32086856 |
T |
 |
| Q |
104 |
ataattgctgaggatttgagtcatggacgtgttggcgatttggtgaag-aaaatctgaatgatacgtacataacaccaaaaattattggatagcagcaac |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32086857 |
ataattgctgaggatttgggtcatggacgtgttggcaatttggtgaagaaaaatctgaatgatacgtacataacaccaaaaattattggatagcagcaac |
32086956 |
T |
 |
| Q |
203 |
tactcctttgttgtttttgtgctgtcaattacttgtt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32086957 |
tactcctttgttgtttttgtgctgtcaattacttgtt |
32086993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University