View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_65 (Length: 240)
Name: NF2504_low_65
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_65 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 41891826 - 41891621
Alignment:
| Q |
15 |
agcataggcaaataaacagttggtgaactcagtttttgaacttatgttgtaattgaatcaattgaaagtaagatttagtagaggataatacacaactcct |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41891826 |
agcagaggcaaataaacagttggtgaactcagtttttgaacttatgttgcaattgaatcaattgaaagtaagatttagtagaggataatacacaactcct |
41891727 |
T |
|
| Q |
115 |
agtagatgcaaattaaagaatgcttcgatatgtcagttgatcaagctgttgaccgttgatattaaattatagctacaaaaataggtgcaattgtatcggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41891726 |
agtagatgcaaattaaagaatgcttcgacatgtcagttgatcaagctgttgactgttgatattaaattatagctacaaaaataggtgcaattgtatcggt |
41891627 |
T |
|
| Q |
215 |
actaat |
220 |
Q |
| |
|
|||||| |
|
|
| T |
41891626 |
actaat |
41891621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University