View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_7 (Length: 594)
Name: NF2504_low_7
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 408; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 130 - 581
Target Start/End: Complemental strand, 47906782 - 47906330
Alignment:
| Q |
130 |
tggccactttagtgtttt-cccctttctgttatttattcttagttagtacgccatgatatttgcttatagtttgtatacttcatgcatgtgattgataag |
228 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47906782 |
tggccactttagtgtttttcccctttctgttatttattcttagttagtacgccatgatatttgcttatagtttgtatacttcatgcatgtgattgataag |
47906683 |
T |
|
| Q |
229 |
ccatattactaaatgattgttgtcctttttatttatcaatactgcaaaagccattcgatgctcgtccaagatggagctgttgccagacgaggttggcctt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47906682 |
ccatattactaaatgattgttgtcctttttatttatcaatactgcaaaagccattcgatgctcgtccaagatggagctgttgccagacgaggttggcctt |
47906583 |
T |
|
| Q |
329 |
cttttctcattccttcaatatgataaattaataaattcctccaatttaagttactattctgctttcatctttcgtacttatttaccttacattgttgtgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47906582 |
cttttctcattccttcaatatgataaattaataaattcctccaatttaagttactattctgctttcatctttcgtacttatttaccttacattgttgtgt |
47906483 |
T |
|
| Q |
429 |
atcggttctatttttacataatgtagacatctgcataactttggaagtgatatgatagtaattcacaattgcttcattttgatctcattgcacataattg |
528 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47906482 |
atcggttctatttttacataatgtagacatctgcataactttggaagtgatatgatagtaattcacaattgcttcattttgtactcattgcacataattg |
47906383 |
T |
|
| Q |
529 |
gtattacttatgtcatttgttctctcnnnnnnnccctctttcaagaagccttc |
581 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
47906382 |
gtattacttatgtattttgttctctctctttttccctctttcaagaagccttc |
47906330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 83 - 113
Target Start/End: Complemental strand, 47906827 - 47906797
Alignment:
| Q |
83 |
gacacattgattgcattgcgaatctatctag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47906827 |
gacacattgattgcattgcgaatctatctag |
47906797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University