View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_71 (Length: 234)
Name: NF2504_low_71
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 38532096 - 38532328
Alignment:
| Q |
1 |
gattatataaaaaagtaaaatgatgaaaatttgcttgtcacatatggtaaaatggctagattattatttgcttctgcttttatatgcaaaaaagttattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38532096 |
gattatataaaaaagtaaaatgatgaaaatttgcttgtcacatatggtaaaatggctagattattatttgcttctgcttttatatgcaaaaaagttattt |
38532195 |
T |
 |
| Q |
101 |
gcttctgcttttatatacaaaaaagtaaagttgcaacatgtaaatatgtataacctctctaatcttcacaacggtatcgctcgaattctagagcactagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38532196 |
gcttctgcttttatatacaaaaaagtaaagttgcaacatgtaaatatgtataacctctcgaatcttcacaacggtatcgctcgaattctagagcactagc |
38532295 |
T |
 |
| Q |
201 |
ttttcttacaagttta----ggttgtcataatt |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
38532296 |
ttttcttacaagtttaattaggttgtcataatt |
38532328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 38532039 - 38532093
Alignment:
| Q |
19 |
aatgatgaaaatttgcttgtcacatatggtaaaatggctagattattatttgctt |
73 |
Q |
| |
|
|||||||||||| ||||||||| | ||| ||| ||||||||||||||||||||| |
|
|
| T |
38532039 |
aatgatgaaaatatgcttgtcataattggcaaagtggctagattattatttgctt |
38532093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University