View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_76 (Length: 211)
Name: NF2504_low_76
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_76 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 10 - 156
Target Start/End: Original strand, 37172947 - 37173091
Alignment:
| Q |
10 |
aagaatattattaataaaatgaatacaaaatcatggggacaaaagaactaaaaacctttaaaatgttaagttcagatctaatccatgtgaattcttaatc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37172947 |
aagaatattattaataaaatgaatacaaaatcatggggacaaa-gaactaaaaacctccaaaatgttaagttcagatctaatccatgtgaattcttaatc |
37173045 |
T |
|
| Q |
110 |
acattctattttagaattggtgtcataattagacggtgacataaaag |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37173046 |
acattctattttagaattggtgtcataattaga-ggtgacataaaag |
37173091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University