View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2504_low_77 (Length: 208)
Name: NF2504_low_77
Description: NF2504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2504_low_77 |
 |  |
|
| [»] scaffold0862 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0862 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0862
Description:
Target: scaffold0862; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 654 - 462
Alignment:
| Q |
1 |
ccgaagaaggagttgatggtggcatcttggagnnnnnnntcgaaggcttgggatcctagatatcttacccctttggtaaatgggtgataggttaaggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
654 |
ccgaagaaggagttgatggtggcatcttggagaaaaaaatcgaaggcttgggatcctagatatcttacccctttggtaaatgggtgataggttaaggttt |
555 |
T |
 |
| Q |
101 |
gagcgcatttaagagatcaatttgaagatagttgaaaccaaccttatatatgcatttatggagagatggcaccaaagatggcatgtggtgtgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
554 |
gagcgcatttaagagatcaatttgaagatagttgaaaccaaccttatatatgcatttatggagagatggcaccaaagatggcatgtggtgtgt |
462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 118 - 171
Target Start/End: Original strand, 28249026 - 28249079
Alignment:
| Q |
118 |
caatttgaagatagttgaaaccaaccttatatatgcatttatggagagatggca |
171 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
28249026 |
caatctgaagatgattgacaccaaccttatatatgcatttgtggagaggtggca |
28249079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University