View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2505_high_22 (Length: 245)

Name: NF2505_high_22
Description: NF2505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2505_high_22
NF2505_high_22
[»] chr3 (2 HSPs)
chr3 (49-142)||(29111026-29111108)
chr3 (1-33)||(29110973-29111005)


Alignment Details
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 49 - 142
Target Start/End: Original strand, 29111026 - 29111108
Alignment:
49 aattaaactttttaacaaatgcgcttgtagtatttccctaattaatatcatatataacaatccacttcacaaagatgttgaaccgacagttcag 142  Q
    ||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||    
29111026 aattaaactttttaacaaatgcgcttgtagtatttccc-----------atatataacaatccacttcacaaagatgttgaaccgacagttcag 29111108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 29110973 - 29111005
Alignment:
1 tactttttattatttcaatgtgttgaaatcaca 33  Q
    ||||||||||||||||||||||||||| |||||    
29110973 tactttttattatttcaatgtgttgaattcaca 29111005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University