View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2505_high_26 (Length: 239)
Name: NF2505_high_26
Description: NF2505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2505_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 27142462 - 27142241
Alignment:
| Q |
5 |
ggtgtcacatcggtttgatccaacgttaatcgccagccaagcttatgtgaaagtaacttgttaagnnnnnnngaatgtcccttttctctttccatcaaaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27142462 |
ggtgtcacatcggtttgatccaacgttaatcgccagccaagcttatgtgaaagtaacttgttaagaaaaaaagaatgtcccttttctctttccatcaaaa |
27142363 |
T |
|
| Q |
105 |
cacgttattataattaatcgaatagaattatgagaatttaatctctctatagccataagatttatgtggtaggtttgcattgggtccatgggttaattta |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27142362 |
cacgttattataattaatcgaatagaattatgagaatttaatctctctatagccataagatttatgtggtaggtttgcattgggtccatgggttaatttg |
27142263 |
T |
|
| Q |
205 |
gccatggtgctaagtactagtt |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27142262 |
gccatggtgctaagtactagtt |
27142241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University