View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2505_low_10 (Length: 357)
Name: NF2505_low_10
Description: NF2505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2505_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 57 - 275
Target Start/End: Complemental strand, 41250589 - 41250375
Alignment:
| Q |
57 |
tgaagttggtggatttaataatcttggtataactttgaatgataatcataattatctctacacttgaatgttggtggtaataacagaaatacaatgaata |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41250589 |
tgaagttggtggatttaataatcttggtataactttgaatgataatcataattatctctacacttgaatgttgttggtaataacagaaatacaatgaata |
41250490 |
T |
|
| Q |
157 |
attaatgtttaggtttggaaaatgtgtgattcaatagtggatccaattgcttcttgaagatgaccttttatggaattagttttagttctagtgcattgat |
256 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41250489 |
at----gtttaggtttggaaaatgtgtgattcaatagtggatccaattgcttcttgaagatgaccttttatggaattagttttagttctagtgcattgat |
41250394 |
T |
|
| Q |
257 |
atctgatagctaaatctta |
275 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41250393 |
atctgatagctaaatctta |
41250375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 41251887 - 41251822
Alignment:
| Q |
1 |
ttaggaagaacaccaccacgaacaatggtaactccaccaaacaattatcagggtgatgaagttggt |
66 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41251887 |
ttaggaagaacaccaccacgagcaatggtaactccaccaaacaattatcagggtgatgaagttggt |
41251822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University