View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2505_low_11 (Length: 317)
Name: NF2505_low_11
Description: NF2505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2505_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 266
Target Start/End: Complemental strand, 1589853 - 1589596
Alignment:
| Q |
9 |
gaagaatattgagcacagaaaagaaaatacagtacatgatatgattggttccatgaaacataagtagtattgctatgagttttgatgagcacgggggcca |
108 |
Q |
| |
|
|||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1589853 |
gaagaaaattcagcacaaaaaagaaaatacagtacatgatatgattggttccatgaaacgtaagtagtattactatgagttttgatgagcacgggggcca |
1589754 |
T |
|
| Q |
109 |
cctgttcacgttctcagaaggtaagagaattaattggtcacatgttatcttttctcaaaatgtatatgcaatttagtgnnnnnnnnactataaataagca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
1589753 |
cctgttcacgttctcagaaggtaagagaattaattggtcacatgttatcttttctcaaaatgtatatgcaatttagagtttattttactataaataagca |
1589654 |
T |
|
| Q |
209 |
attatagagttaatttgaaatatttaatcaatttttctaaaatgaagtggcaaataca |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1589653 |
attatagagttaatttgaaatatttaatcaatttttctaaaatgaagtggcaaataca |
1589596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University