View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2505_low_24 (Length: 249)
Name: NF2505_low_24
Description: NF2505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2505_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 16 - 141
Target Start/End: Original strand, 38756877 - 38757002
Alignment:
| Q |
16 |
taattgtcacttttttcataaatcttttattgcacaaattaatacattttgtgtgaatctcaatgcttgagagtcaaagaatagtcaatatttatttaaa |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38756877 |
taattgtcacttttttcttaaatcttttattgcacaaattaatacattttgtgtgaatctcaatgcttgagagtaaaagaatagtcaatatttatttaaa |
38756976 |
T |
 |
| Q |
116 |
gagaagacatctttgaacataatttt |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38756977 |
gagaagacatctttgaacataatttt |
38757002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 136 - 239
Target Start/End: Original strand, 38757395 - 38757499
Alignment:
| Q |
136 |
aattttctataggtaccgattattattaactaatagtattattttttatgaacaaatg-nnnnnnnactaattattagtattaatatgttttattagtac |
234 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| | ||||||||||||||| ||||||||||||||| |
|
|
| T |
38757395 |
aattttctataggtaccgattattactaactaatagtattattttgtatgaacaaatgttttttgtattaattattagtattattatgttttattagtat |
38757494 |
T |
 |
| Q |
235 |
ctatg |
239 |
Q |
| |
|
||||| |
|
|
| T |
38757495 |
ctatg |
38757499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University