View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2505_low_26 (Length: 245)
Name: NF2505_low_26
Description: NF2505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2505_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 49 - 142
Target Start/End: Original strand, 29111026 - 29111108
Alignment:
| Q |
49 |
aattaaactttttaacaaatgcgcttgtagtatttccctaattaatatcatatataacaatccacttcacaaagatgttgaaccgacagttcag |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29111026 |
aattaaactttttaacaaatgcgcttgtagtatttccc-----------atatataacaatccacttcacaaagatgttgaaccgacagttcag |
29111108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 29110973 - 29111005
Alignment:
| Q |
1 |
tactttttattatttcaatgtgttgaaatcaca |
33 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
29110973 |
tactttttattatttcaatgtgttgaattcaca |
29111005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University