View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2505_low_31 (Length: 239)
Name: NF2505_low_31
Description: NF2505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2505_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 2629774 - 2629564
Alignment:
| Q |
17 |
caagattgaaacaagaaagnnnnnnngaacaatggttcgaaaaggtgatattgtttgggtaagagaaatttacttccctcacaacaacaac---tacaat |
113 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
2629774 |
caagattgaaacaagaaagaaaaaaagaagaatggttcgaaaaggtgatattgtttgggtaagagaaattcagttccctcacaacaacaacaactacaat |
2629675 |
T |
 |
| Q |
114 |
tggtctccagctttagttaaatcttccaacaacctcggcatctcactttccttcttcaacaaccccaaccccacacaacgcaccttctttcttcaatccg |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2629674 |
tggtctccagctttagttacatcttccaaccacctcggcatctcactttccttcttcaacaaccccaacaccacacaacgcaccttctttcttcaatccg |
2629575 |
T |
 |
| Q |
214 |
aggttattcct |
224 |
Q |
| |
|
| ||||||||| |
|
|
| T |
2629574 |
aagttattcct |
2629564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University